Seudónimo Seudónimo

06-11-2019
Mathematics

contestada

Is 3 a multiple of 9? yes or no

Respuesta :

2018063 2018063

06-11-2019

Answer:

Yes it is

The reason is because if you divide 9 by 3, you will get 3.

Answer Link

cfsleminl cfsleminl

26-11-2019

Answer:

yes 3 is

Step-by-step explanation:

3 dived by 9 is 3
3 times 3 is 9

Answer Link

Otras preguntas

Sculptures and cave paintings were a development of which period?

Find the volume of this triangular prism. Dimensions are in inches

Which sentence is the hook in this introductory paragraph? For the first time in decades, Baby Boomers have been outnumbered by another group--the Millennials.

Match each description with the correct word. 1. performing a task unconsciously automatism 2. Surrealists believed that artists needed to escape the oppress

How many floors did a typical early roman house have

A company’s profit is modeled by the function p(x) = -2x2 + 60x − 2, where p is the profit in thousands of dollars and x is the number of units sold in hundreds

Examples of infections caused by indirect transmission of disease agents include: vehicle-borne infections airborne infections vector-borne infections all of th

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

what is the difference between the least number of minutes jumpes and the greatest minutes jumped?

How would you know if your results from experiment 2 show that the traits were inherited through mendelian genetics?