steven0182 steven0182

09-01-2020
Mathematics

contestada

Mattias bought a package of 5 notebooks for $13.95. What is the unit price per notebook?

Respuesta :

weibo3705 weibo3705

09-01-2020

Answer:

2.79

Step-by-step explanation:

this solution:

5x=13.95

x=13.95/5

x2.79

so answer is 2.79

Answer Link

annabellerhame07 annabellerhame07

09-01-2020

Answer:For one note book is $2.79

Step-by-step explanation:you would divide 13.95 by 5 and get it

Answer Link

Otras preguntas

004 1.0 points What volume of oxygen gas can be collected at 0.565 atm pressure and 26.0°C when 40.8 g of KCIO3 decompose by heating, according to the following

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Davenport Inc. offers a new employee a lump sum signing bonus at the date of employment.Alternatively, the employee can take $30,000 at the date of employment

What is the first stage years for the triangular trade

Am confuse I don’t get it

I NEED ANSWERS ASAP IM IN CLASS!! IM DESPERATE!!! PLZ Match the each of the nouns on the left with its definition on the right. You may use a dictionary. 1. co

How to get the right answer

EXTRA points! Why do you think state and local governments have a major role in providing important services? why doesn’t the federal government take on more of

Read each passage from Heart of a Samurai. Which description gives readers the best idea of how Manjiro is feeling? “Manjiro stared at the strangers when he th

Convert 47°F to degrees Celsius. If necessary, round your answer to the nearest tenth of a degree. Here are the formulas. C (F-32) F=C+32