mintyxplayz mintyxplayz

10-06-2020
Physics

contestada

What is shown in the diagram?

an electromagnet

a turbine

a motor

a generator

What is shown in the diagram an electromagnet a turbine a motor a generator class=

Respuesta :

rosesssYT rosesssYT

10-06-2020

Answer:

an electromagnet

Explanation:

Answer Link

kochiyusuf kochiyusuf

06-05-2021

Answer:

the answer is actually D.

A Generator

the guy above me is wrong

......pls brainliest

Answer Link

Otras preguntas

What is wrong with the following sentence? Mrs Scott assigned whoever late extra homework. A. The noun clause is missing a verb. B. The noun clause isn't

The central theme of the Bible is prophecy. True False

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

A student compares two different proteins. The student notices that the primary structures differ in both the number of amino acids and the sequence of amino ac

Lake crystal mn recently experienced a 20% increase in electricity rates. what action would you recommend residents take to use electricity more efficiently?

How do you reflect an image across the y axis

My mother was disappointed with my grades, so she decided to reduce my television and computer time. A) a noun phrase that functions as the subject B) an infin

A company is expanding its building area from 12,500 square feet to 15,375 square feet. What is the percentage increase of the area of the building space? A.

Pericles is MOST known for

What does “The ruin of a nation begins in the homes of its people,” mean?