dmazhwfwxd dmazhwfwxd

06-10-2020
Mathematics

contestada

Enter the sum of numbers as a product of their GCF.
30 + 36
The sum of the numbers as a product of their GCF is

Respuesta :

Nicolletta Nicolletta

06-10-2020

Their GCF is 6 and the sum is 66

Step-by-step explanation:

Answer Link

Otras preguntas

Use 3.14 = 7 to find the volume of the composite shape below. 15 in 20 in 18 in The total volume of this composite shape is

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha

ILL GIVE BRAINLIEST!! Find y. Give your answer in the simplest form. 45°

Please help or else your not getting a signed autograph by Shrek!

what is the effect on market when suppliers under invest in their businesses

help me pleaseeee question: What were the events that helped the United States economy grow?

Which is one step to take when summarizing a text

8.A school has to hire someseven-seater maxi-taxis to take150 students on a field trip.a) How many seven-seaters will the schoolhave to hire?Answer =b) If one o

Cal Lury owes $21,000 now. A lender will carry the debt for five more years at 6 percent interest. That is, in this particular case, the amount owed will go up

Find the value of unknown figure plz tell i will mark as brainliest