jujingyi80 jujingyi80

09-10-2020
Mathematics

contestada

I need help ASAP
Which statement best describes points P and Q?

I need help ASAP Which statement best describes points P and Q class=

Respuesta :

cracked123 cracked123

09-10-2020

Answer:

their y coordinates are the same

Step-by-step explanation:

Answer Link

bradencarter bradencarter

09-10-2020

Answer:

Their y-coordinates are the same.

Step-by-step explanation:

Point P is at (-6, 4) and Point Q is at (1, 4).

Notice how their y-values, which is 4, are the same.

Answer Link

Otras preguntas

We have been able to estimate the age of Earth based on radiometric dating of meteorite materials. True or False

I need some help with my english hw can anyone help?

Angles C and D are supplementary, if angle C equals 126, what is angle D

A climate cycle in the Pacific Ocean with a global impact on weather patterns is called ________. The cycle begins when warm water in the western tropical Pacif

Is the sum of an odd number and an even number, even?

Which term refers to the plot element that provides background information in a story?

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Please help me out I need it soon

What was the “Second Great Awakening”? A. a religious movement characterized by born-again Christian conversions B. a widely read story written by Washington Ir

I need some math help.