ashleygarcia090817 ashleygarcia090817

06-01-2021
Biology

contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4 homadison4

09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

A stock has an expected return of 13.5 percent, its beta is 1.40, and the expected return on the market is 11.5 percent. What must the risk-free rate be? (Do no

PLEASE - Select the correct answer.

What is the reason for the increase and decrease size of the moon and write down in a paragraph.

An organ pipe open at both ends is 1.5 m long. A second organ pipe that is closed at one end and open at the other is 0.75 m long. The speed of sound in the roo

Please answer this question now

Some of the most common applications of real options are with property and insurance. A real estate option grants the holder the right to buy or sell a piece of

What is the slope of the line shown below? A. -3/2 B. 3/2 C. 2/3 D. -2/3

if a flight to europe takes about 13 hours and you make one round trip flight per month how many total days do you travel in a year

If you were able to write a screenplay for any historically important person (must be alive), who would you choose and why?

Stock A has a beta of 1.2, and stock B has a beta of 1. The returns of stock A are ______ sensitive to changes in the market than are the returns of stock B. A.