Elizabethtienna Elizabethtienna

09-04-2021
Biology

contestada

Use the word box below to label the main features of a cladogram.

Use the word box below to label the main features of a cladogram class=

Respuesta :

trgxydjxyhrde trgxydjxyhrde

09-04-2021

Answer:

Explanation:

number 4 is node

Answer Link

Otras preguntas

Can a chord also be classified as a radius? Explain your answer.

The generation of a magnetic field by an electric current is blank...

The points at which a quadratic equation intersects the x-axis are referred to as

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

A varies jointly as b and c. Find when b = 7 and c = 9, if the constant is the variation is 3. A) 189 B) 7/3 C) 21

Spanish Homework.I need 8 more examples.1. Mi amigo, envía el cartas.2. Kenny, prepara los comidas.I will approve if what your answer is what I am looking for.

Which word means "a long, metal-tipped weapon used by knights or soldiers; or any sharp, pointed instrument"?

According to robert sternberg, companionate love develops when _________ is (are) present. infatuation passion and intimacy intimacy and decision/commitment pas

Some members of society consider Eva to be a burden because she is 70 years old and no longer physically capable of working. What is this an example of? A. B

What is the vertex of the graph y = x^2 + 6x - 5 ?