PrinceHuncho PrinceHuncho

06-06-2021
Mathematics

contestada

Find the volume of the prism

Find the volume of the prism class=

Respuesta :

mariahhsanchez99 mariahhsanchez99

06-06-2021

Answer:

D

Step-by-step explanation:

you just add it all up 10+6+8

Answer Link

senalvidun senalvidun

06-06-2021

Answer:

volume of the prism=8×6×10

=480 in²

Answer Link

Otras preguntas

Match each type of energy with its description or example. light heat chemical mechanical electrical A. the energy in your food is an example B. the kinetic e

Forces that bind a state together are ________ forces. a. centripetal b. unitary c. centrifugal d. federal

The ratio of working-age adults to adults aged 65 and older in a population is called the

There are 453.592 grams in one pound . A semi slick , Kevlar tire weighs about 520 grams . What is the tires weighs in pounds ?

What is the formula managers use to calculate their other expense costper guest? other expense (x) number of guests served = other expense cost perguest other e

In 1919, when the u.s., france, and britain hammered out the treaty of paris that supposedly ended world war i, one of the provisions was the league of nations-

The mineral most closely associated with proper immune function:

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What is the situational irony in the excerpt from “Shooting an Elephant” by George Orwell?

What is the y-value of sin(x) when x = -90°?