E9mi1llagisePau E9mi1llagisePau

10-01-2017
Mathematics

contestada

Least to greatest 6.108, 6.6,6.1062,6.16

Respuesta :

brainiac299 brainiac299

10-01-2017

6.1062, 6.108, 6.16, 6.6

Answer Link

Otras preguntas

HELP IM GIVING 20 POINTS AND BRAINLY What is the correlation coefficient r for the data set? Enter your answer to the nearest hundredth in the box. r = x

Some members of society consider Eva to be a burden because she is 70 years old and no longer physically capable of working. What is this an example of? A. B

A solution mass of 1 kg is ___ times greater than 100 g, thus one kilogram (1 kg) of a 2.5% ki solution would contain _____ of ki.

Which of the following is equal to the rational expression when x ≠ 5 or -1? [tex] \frac{(x-7)(x+1)}{(x+1)(x-5)} [/tex] a. [tex] \frac{x+1}{x-7} [/tex] b. [tex]

Identify the element that has a ground state electronic configuration of [ar]4s23d104p 3 .

After mrs. booker was diagnosed with a terminal illness, she decided to consult with multiple specialists. according to kübler-ross, this decision is consistent

An antifreeze solution freezes at -100 °c. what is the freezing point on the fahrenheit scale? -82 °f -212 °f -88 °f -73 °f -148 °f

Frequent nightmares, insomnia, and the intrusion of painful memories are symptoms most commonly associated with:

the overall charge of the nucleus is ______

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3