tinneypop tinneypop

10-12-2021
English

contestada

What can you infer based on
this passage?
A. Buck is over 90 years old.
B. Buck's life of ease left him feeling
better than he really was.
C. Buck is a spoiled child.

Respuesta :

ivogilmore ivogilmore

10-12-2021

Answer:

im pretty sure its b but not 100% sure. it does make sense if its b. good luck tho

Answer Link

Otras preguntas

who is big brain me or you

In "The Hive Mind'', how does the author use the section "How to Study a Bee Brain" to describe how scientists overcome a challenge in studying bee brains? Answ

How did peasant populations often react to the absolutist rule of their monarchs?

The double number lines show the ratio of minutes to days. How many minutes are in 2 days?

on a certain day the temperature at midday was 14°c.By midnight the temperature had fallen by 17°c what was the temperature at midnight

If a human body system does not function correctly what is most likely result?

if two angles are congruent, their ____________ are the same

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Someone help me 40 points

Finding the equation of the line