atreazure atreazure

09-03-2022
Biology

contestada

What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA class=

Respuesta :

karisoar karisoar

09-03-2022

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Answer Link

Otras preguntas

I and my mom are not talkative.....

Match the plot vocabulary to its story event from "The Lottery." The villagers stone Tessie. The villagers discover Tessie has the paper with the black spot. It

PLEASE HELP MEE Discuss two visual effects that have been used.

a cognitive distortion is described as: please choose the correct answer from the following choices, and then select the submit answer button. a descriptive, me

Is there any way this document could be used to argue against quitting? Valley forge page 78

1. A solar lease customer built up an excess of 17,500 kilowatt hours (kwh) during the summer using his solar panels. When he turned his electric heat on, the e

a postmenopausal client wishes to increase the amount of vitamin d that she consumes to help keep her bones strong

Which of the following best explains Hamlet’s own reasoning for following Claudius’s instructions when ordered to go to England?

I can not fail this quiz again so can you help me

Joe bought a new car for $22,560. He received $4,750 for his trade-in. How much state sales tax did he pay if the Arizona state sales tax rate is 8.2%?