A person with damage to this part of the brain (indicated by the arrow) will have normal acoustic reflexes but will have difficulty performing which of the following functions?*interpreting sounds and recognizing a pattern in themdirecting a variety of motor reflexes to sounddirecting input from the thalamus to the brainstemsending auditory information to the midbrain

Question

09-12-2022
Biology

contestada

A person with damage to this part of the brain (indicated by the arrow) will have normal acoustic reflexes but will have difficulty performing which of the following functions?*interpreting sounds and recognizing a pattern in themdirecting a variety of motor reflexes to sounddirecting input from the thalamus to the brainstemsending auditory information to the midbrain

Respuesta :

Otras preguntas

Which verb form correctly completes this sentence? L’année prochaine je ______ du bénévolat pour protéger les animaux en voie de disparition. A. ferai B

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

In the computer lab, there are 14 Apple computers and 16 Pc computers . Approximately what percent of the computers are PCs?

When the Greeks attack the western wall of Troy, they use the night to hide their advances. True False

Two trains leave a city at 1 P.M. One train goes north at a constant rate of 75 mph. The other goes south at a constant rate of 63 mph. At what time will the tr

i dont know this please any help would be nice

which of these expressions is equal to 6 + (2 + 3) x 5 ?

Please help asap 25 pts

Which of the following best explains the trends in atomic radii down a group? It increases because the electron cloud expands, covering more space. It decrea

Will give brainiest 1. How does the “Archon” of ancient Greece relate to our government today? 2. How does the “Council of 500” from ancient Greece rela

NomulaHarsh NomulaHarsh · Answer 1 · 2022-12-14T02:37:23+01:00

A person with damage to this part of the brain will have normal acoustic reflexes but will have difficulty interpreting sounds and recognizing a pattern in them.

What is an acoustic reflex?

The stapedius muscle contracts when an acoustically loud sound is presented, and this is known as the acoustic reflex. The stapedius muscles on both sides tighten in response to loud sounds in either ear. It is a middle ear muscle spasm that happens uncontrollably in reaction to loud sound stimuli or when someone begins to speak.

Hence, the answer is a person with damage to this part of the brain will have normal acoustic reflexes but will have difficulty interpreting sounds and recognizing a pattern in them.

To learn more about acoustic reflex, follow the link: https://brainly.com/question/29727145

#SPJ4