Smarty1415 Smarty1415

10-01-2018
English

contestada

Hi guys i would really love your help please
Read the sentence below:

"A wise man will not leave the right to the mercy of chance…"

In this context, what does the word chance mean?

1. Luck
2.Forgiveness
3.Incidence
4.Privilege

Respuesta :

WindsorLynne WindsorLynne

10-01-2018

In this context, the word chance means Privilege.

I hope this helps and have an awesome day! :)

Answer Link

Otras preguntas

Find an equation of the circle whose diameter has endpoints , 6−2 and , −4−4 .

Unsaved If you are studying the effects of UV rays on eyesight and you group 10 people together and make them wear sunglasses for 10 weeks and see if their eye

Kinetic energy is the energy of motion. a) True b) False

The number of nails of a given length is normally distributed with a mean length of 5.00 in. and a standard deviation of 0.03 in. Find the number of nails in a

How were western lands to be dealt with under the articles?

Explain to what extent nato is membership in this organization was a continuation or departure from us foreign policy

business question please help i have to have this done by tomorrow or i will get an F

By the end of early adulthood, the most common reason for death is

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

number 4 plewse asap plzzzzzzzz its due tomorrow i dont know how to do it