talbright3321 talbright3321
  • 06-02-2018
  • English
contestada


HELP PLSS
What is this group of words?

The girl with a curl.

Respuesta :

kimihoto
kimihoto kimihoto
  • 06-02-2018
well, it rhymes. do you have a further explanation? are there answer choices?
Answer Link
Аноним Аноним
  • 06-02-2018
fragment  i hope this helps you
Answer Link

Otras preguntas

Plz help me vocabulary
PLEASE HURRY!! PLEASE! What energy changes carbon dioxide in plant cells into sugars. A. kinetic B. light C. heat D. water
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
how many heavier is 9 pounds 20 ounces than 160 ounces (1 pound = 16 ounces)
Summarize of two roads chapter 22
What were the goals of the Republicans in the late 1800s?
30 points and brainlist question on the photo number 25 only
Find the area of the semicircle Either enter an exact answer in terms of * or use 3.14 for and enter your answer as a decimal units
A rectangle has a perimeter of 25 meters. If the lengths of the sides of the rectangle are multiplied by 7 to make a new rectangle, what is the perimeter of the
how many fiths are equivilant to 6/10