pinkpitbull00 pinkpitbull00

09-04-2020
History

contestada

what is a modern day result of the Spainish colonization of the americas

Respuesta :

tedlutaj tedlutaj

09-04-2020

Answer:

The majority of south and central american countries use spanish as an official language

Answer Link

Otras preguntas

Your friend, who is a psychology major, tells you, "I was at a party last night and during the party, my general level of arousal increased. Since everyone at t

which of the following italicized words is NOT classic correctly ?

Marilee's Electronics uses a periodic inventory system and the average cost retail method to estimate ending inventory and cost of goods sold. The following dat

I need help on this question

Dr. Berenstein holds the view that behavior is merely a surface characteristic and that a-true understanding of development requires analyzing the symbolic mean

WAHME2.TOUnichtTHE1990ATARAOTELASUADAWALA CLASSESonand1566eTEVERHAAL-ortthLugo..16. Read the lines below. Then answer the question using the character list. 1pW

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

Stateful packet inspection firewalls ________. always do application content filtering have the slow speed of relay operation Both always do application content

Steinway produces concert grand pianos, often using the custom materials and designs desired by a specific customer. The average price of these pianos runs abou

how do you factor out the GCF of 81x - 27