escobarbryan2006 escobarbryan2006

08-06-2020
History

contestada

During the Gilded Age, factories hired unskilled workers to

Respuesta :

ijimmyjohn ijimmyjohn

08-06-2020

Save themselves money

Answer Link

03-09-2020

Answer:

operate machines.

Explanation:

Took the test

Answer Link

Otras preguntas

Time taken by a randomly selected applicant for a mortgage to fill out a certain form has a normal distribution with mean value 9 min and standard deviation 3 m

The current account includes __________. a. the export and import of goods and services. b. all purchases and sales of assets such as stocks, bonds, bank accou

The ability of lizards to recognize their predators via tongue flicks can often mean life or death for lizards. Seventeen juvenile common lizards were exposed t

scientist discover the preserved remains of a woolly mammoth and want to determine its age well examining a sample from the bones the scientist discover the spe

Me gusta _______________ la televisión. azar acampar mirar cazar

A student performs Young’s double-slit experiment with slits that are separated by 0.160 mm. She observes the interference pattern on a screen 60.0 cm from the

When negative externalities are present in a market A. choices private costs are greater than social costs B. social costs are greater than private costs C.

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

Excerpt from “The Cloak” How do the actions of the two men in the final paragraph help develop the theme? A. by conveying how the men understand the cost of tru

James and two cousins received the same amount of money to go to the arcade. Each person spent $15. Afterwords, they had $30 altogether. How much money did each