shlebby16 shlebby16

10-10-2016
Biology

contestada

A homogeneous mixture of two or more substances is called

Respuesta :

mpanderla95 mpanderla95

10-10-2016

A homogeneous mixture of two or more substances is called a solution.

Answer Link

Danielannx3 Danielannx3

10-10-2016

A homogeneous mixture of two or more substances is called____.

A solution is a homogeneous mixture of two or more substances in a single phase.

Answer: Solution.

Answer Link

Otras preguntas

1. En Guadalajara, la gente come bien. lógico / ilógico 2. No hay estadios de fútbol en Guadalajara. lógico / ilógico 3. En Guadalajara, los turistas visitan

You are on a house call with the veterinarian to evaluate some goats that are having "night blindness" per the owner. Upon arrival you can see that the goats ha

Find the area of the regular polygon. Round to the nearest tenth.

Your plumber charged a fee of $60 and an additional $21.50 per hour for a repair visit. Your bill was $124.50. How long was the plumber's repair visit?

Technician A says that battery corrosion is commonly caused by spilled electrolyte. Technician B says that battery corrosion is commonly caused by electrolyte c

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

One of the newest applications of cell technology is called side braid and Rios this process involves replacing the nuclear material of an animal cell with the

At age 6 what was Muhammad

I need help! FAST!!!

Which expressions are equivalent to the one below? Check all that apply.9^xОА. 9. 9x - 1В. 9. 9х+1с. 36/4^xD.x^5Е. 36